Variants from Dubai Health Genomic Medicine Center, Dubai Health with conflicting interpretations

Minimum review status of the submission from Dubai Health Genomic Medicine Center, Dubai Health:		Collection method of the submission from Dubai Health Genomic Medicine Center, Dubai Health:
Minimum review status of the other submission:		Collection method of the other submission:
Minimum conflict level: Report conflict between different conditions
Show significances as they were submitted (without aggregation into standard terms)

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition	Variants with at least 2 submissions on the same condition and no conflicts	Variants with a synonymous conflict (e.g. benign vs non-pathogenic)	Variants with a confidence conflict (e.g. benign vs likely benign)	Variants with a benign or likely benign vs uncertain conflict	Variants with a category conflict (e.g. benign vs affects)	Variants with a clinically significant conflict (e.g. benign vs pathogenic)	Variants with any conflict
804	381	3	284	121	7	91	440

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

	All submitters
Dubai Health Genomic Medicine Center, Dubai Health		pathogenic	likely pathogenic	uncertain significance	likely benign	benign	affects	drug response	other
	pathogenic	2	98	21	2	0	2	2	1
	likely pathogenic	92	1	32	2	2	0	0	0
	uncertain significance	21	18	0	43	7	1	0	0
	likely benign	3	4	51	0	22	0	0	0
	benign	6	3	23	74	0	1	0	1

Submitter to submitter summary #

Total submitters: 155

Download table as spreadsheet

Submitter	Variants with only 1 submission per condition	Variants with at least 2 submissions on the same condition and no conflicts	Variants with a synonymous conflict (e.g. benign vs non-pathogenic)	Variants with a confidence conflict (e.g. benign vs likely benign)	Variants with a benign or likely benign vs uncertain conflict	Variants with a category conflict (e.g. benign vs affects)	Variants with a clinically significant conflict (e.g. benign vs pathogenic)	Variants with any conflict
Labcorp Genetics (formerly Invitae), Labcorp	0	213	0	43	31	1	12	87
GeneDx	0	144	0	30	14	0	10	54
OMIM	0	79	1	28	1	5	10	45
CeGaT Center for Human Genetics Tuebingen	0	64	0	20	13	0	7	40
Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre	0	45	0	28	1	0	8	37
Illumina Laboratory Services, Illumina	0	51	0	11	22	0	2	35
Breakthrough Genomics, Breakthrough Genomics	0	57	0	28	0	0	2	30
Women's Health and Genetics/Laboratory Corporation of America, LabCorp	0	82	0	16	7	0	6	29
Fulgent Genetics, Fulgent Genetics	0	74	0	20	3	0	5	28
Revvity Omics, Revvity	0	77	0	8	11	0	9	28
Eurofins Ntd Llc (ga)	0	60	0	8	15	0	3	26
Mayo Clinic Laboratories, Mayo Clinic	0	48	0	5	10	0	6	21
Department of Pathology and Laboratory Medicine, Sinai Health System	0	18	0	8	5	0	7	20
PreventionGenetics, part of Exact Sciences	0	69	0	8	7	0	5	20
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories	0	52	0	7	7	0	4	18
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center	0	28	0	13	3	0	1	17
Natera, Inc.	0	53	0	13	2	0	2	17
Baylor Genetics	0	73	0	9	1	0	6	16
Counsyl	0	11	0	9	1	0	5	15
Genetic Services Laboratory, University of Chicago	0	29	0	12	2	0	0	14
Genome-Nilou Lab	0	32	0	9	4	0	1	14
Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+	0	11	0	11	0	0	1	12
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine	0	44	0	5	2	0	5	12
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC)	0	6	0	11	1	0	0	12
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics	0	9	0	9	1	0	0	10
3billion	0	58	0	6	2	0	1	9
Victorian Clinical Genetics Services, Murdoch Childrens Research Institute	0	38	0	6	0	0	3	9
Genome Diagnostics Laboratory, University Medical Center Utrecht	0	26	0	6	2	0	0	8
Mendelics	0	25	0	3	1	0	3	7
Ambry Genetics	0	22	0	1	3	0	2	6
Centre for Mendelian Genomics, University Medical Centre Ljubljana	0	7	0	3	2	0	1	6
Department of Genetics, Sultan Qaboos University Hospital	0	18	0	5	0	0	1	6
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen	0	14	0	4	2	0	0	6
First Genomix Gene Laboratory, Genetic Diagnostics Department	0	18	0	2	0	0	4	6
Genomic Research Center, Shahid Beheshti University of Medical Sciences	0	8	0	4	0	0	2	6
Variantyx, Inc.	0	19	0	5	0	0	1	6
Biochemical Molecular Genetic Laboratory, King Abdulaziz Medical City	0	11	0	4	0	0	1	5
Blueprint Genetics	0	7	0	2	0	0	3	5
Genome Diagnostics Laboratory, Amsterdam University Medical Center	0	14	0	4	1	0	0	5
Juno Genomics, Hangzhou Juno Genomics, Inc	0	12	0	4	0	0	1	5
Laboratory of Genetics, Children's Clinical University Hospital Latvia	0	9	0	2	1	0	2	5
Neuberg Centre For Genomic Medicine, NCGM	0	34	0	3	1	0	1	5
CENTOGENE GmbH and LLC - Guiding Precision Medicine	0	18	0	4	0	0	0	4
Clinical Genetics, Academic Medical Center	0	10	0	2	1	0	1	4
Institute of Human Genetics, Univ. Regensburg, Univ. Regensburg	0	4	0	4	0	0	0	4
Institute of Human Genetics, University of Leipzig Medical Center	0	32	0	1	1	0	2	4
Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein	0	13	0	3	1	0	0	4
Laboratory of Medical Genetics, National & Kapodistrian University of Athens	0	10	0	3	0	0	1	4
MGZ Medical Genetics Center	0	15	0	3	0	0	1	4
Molecular Genetics, Royal Melbourne Hospital	0	4	0	1	1	0	2	4
Athena Diagnostics	0	25	0	2	1	0	0	3
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital	0	11	0	2	1	0	0	3
Dasa	0	25	0	1	0	0	2	3
Dubai Health Genomic Medicine Center, Dubai Health	1612	10	1	1	0	0	1	3
Elsea Laboratory, Baylor College of Medicine	0	0	0	1	0	0	2	3
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne	0	12	0	2	0	0	1	3
Genomics England Pilot Project, Genomics England	0	4	0	3	0	0	0	3
Gharavi Laboratory, Columbia University	0	0	0	0	2	0	1	3
Laboratory of Diagnosis and Therapy of Lysosomal Disorders, University of Padova	0	1	0	2	0	0	1	3
Laboratory of Prof. Karen Avraham, Tel Aviv University	0	0	0	0	0	0	3	3
Lifecell International Pvt. Ltd	0	7	0	3	0	0	0	3
Myriad Genetics, Inc.	0	20	0	3	0	0	0	3
Reproductive Health Research and Development, BGI Genomics	0	3	1	0	0	0	2	3
Solve-RD Consortium	0	0	0	3	0	0	0	3
Biesecker Lab/Clinical Genomics Section, National Institutes of Health	0	3	0	2	0	0	0	2
Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard	0	9	0	2	0	0	0	2
Centre of Medical Genetics, University Hospital Muenster	0	3	0	1	0	0	1	2
ClinGen Lysosomal Storage Disorder Variant Curation Expert Panel	0	2	0	1	0	0	1	2
Clinical Genetics Laboratory, Skane University Hospital Lund	0	16	0	1	0	0	1	2
Clinical Genetics Laboratory, University Hospital Schleswig-Holstein	0	3	0	1	0	0	1	2
Clinical Genomics Laboratory, Stanford Medicine	0	3	0	0	2	0	0	2
Color Diagnostics, LLC DBA Color Health	0	4	0	0	1	0	1	2
Division of Human Genetics, Children's Hospital of Philadelphia	0	4	0	2	0	0	0	2
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics, Children's Hospital of Philadelphia	0	8	0	1	1	0	0	2
Hadassah Hebrew University Medical Center	0	1	0	0	0	0	2	2
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology	0	8	0	2	0	0	0	2
NHS Central & South Genomic Laboratory Hub	0	1	0	1	0	0	1	2
NIHR Bioresource Rare Diseases, University of Cambridge	0	2	0	1	0	0	1	2
Palindrome, Gene Kavoshgaran Aria	0	1	0	2	0	0	0	2
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego	0	18	0	1	0	0	1	2
SingHealth Duke-NUS Institute of Precision Medicine	0	0	0	1	0	0	1	2
Suma Genomics	0	4	0	1	0	0	1	2
UCLA Clinical Genomics Center, UCLA	0	1	0	1	0	0	1	2
Undiagnosed Diseases Network, NIH	0	3	0	1	1	0	0	2
University of Washington Center for Mendelian Genomics, University of Washington	0	1	0	1	0	0	1	2
Yale Center for Mendelian Genomics, Yale University	0	1	0	2	0	0	0	2
AiLife Diagnostics, AiLife Diagnostics	0	0	0	0	0	0	1	1
Biochemistry Laboratory of CDMU, Chengde Medical University	0	0	0	1	0	0	0	1
CFTR-France	0	5	0	1	0	0	0	1
CSER _CC_NCGL, University of Washington	0	0	0	1	0	0	0	1
Caryl and Israel Englander Institute for Precision Medicine, Weill Cornell Medicine	0	0	0	0	0	0	1	1
Cavalleri Lab, Royal College of Surgeons in Ireland	0	1	0	1	0	0	0	1
CeMIA	0	0	0	0	1	0	0	1
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago	0	2	0	0	1	0	0	1
Center for Molecular Medicine, Children’s Hospital of Fudan University	0	1	0	1	0	0	0	1
Centre for Genomic Medicine, Manchester, Central Manchester University Hospitals	0	0	0	1	0	0	0	1
Centre for Population Genomics, CPG	0	2	0	1	0	0	0	1
ClinGen Malignant Hyperthermia Susceptibility Variant Curation Expert Panel, ClinGen	0	0	0	0	1	0	0	1
ClinGen von Willebrand Disease Variant Curation Expert Panel, ClinGen	0	0	0	0	0	0	1	1
ClinPGx	0	0	0	0	0	1	0	1
ClinVar Staff, National Center for Biotechnology Information (NCBI)	0	2	0	1	0	0	0	1
Clinical Genetics Laboratory, Department of Pathology, Netherlands Cancer Institute	0	0	0	1	0	0	0	1
Clinical Genomics Laboratory, Washington University in St. Louis	0	3	0	1	0	0	0	1
Clinical Laboratory Sciences Program (CLSP), King Saud bin Abdulaziz University for Health Sciences (KSAU-HS)	0	8	0	1	0	0	0	1
Clinical Molecular Genetics Laboratory, Johns Hopkins All Children's Hospital	0	3	0	1	0	0	0	1
DBGen Ocular Genomics	0	1	0	1	0	0	0	1
Dan Cohn Lab, University Of California Los Angeles	0	0	0	1	0	0	0	1
Department of Clinical Genetics, Copenhagen University Hospital, Rigshospitalet	0	0	0	0	0	0	1	1
Department of Human Genetics, Hannover Medical School	0	12	0	1	0	0	0	1
Department of Pediatrics, Gifu University	0	0	0	1	0	0	0	1
Diagnostics Division, CENTRE FOR DNA FINGERPRINTING AND DIAGNOSTICS	0	0	0	1	0	0	0	1
Diagnostics Services (NGS), CSIR - Centre For Cellular And Molecular Biology	0	0	0	0	1	0	0	1
Dr.Nikuei Genetic Center	0	1	0	1	0	0	0	1
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics	0	7	0	1	0	0	0	1
Fundacion Favaloro, PRICAI	0	0	0	1	0	0	0	1
GenePathDx, GenePath diagnostics	0	0	0	1	0	0	0	1
Genetic Diseases Diagnosis Center, Ankara Bilkent City Hospital	0	0	0	1	0	0	0	1
Genetics Laboratory, Great Ormond Street Hospital NHS Foundation Trust, North Thames Genomic Laboratory Hub	0	3	0	1	0	0	0	1
Genetics and Genomic Medicine Centre, NeuroGen Healthcare, NeuroGen Healthcare	0	3	0	0	1	0	0	1
Genetics and Molecular Pathology, SA Pathology	0	13	0	0	0	0	1	1
GenomeConnect - Simons Searchlight	0	3	0	1	0	0	0	1
Genomics Facility, Ludwig-Maximilians-Universität München	0	1	0	1	0	0	0	1
Giacomini Lab, University of California, San Francisco	0	0	0	0	0	0	1	1
Human Genetics Bochum, Ruhr University Bochum	0	3	0	0	0	0	1	1
Human Genetics School of Medicine of Albacete, Castilla-La Mancha University	0	0	0	0	0	0	1	1
IIFP, CONICET-UNLP	0	0	0	0	0	0	1	1
ITMI	0	5	0	1	0	0	0	1
Immunogenetics and Transplant Biology Service, University Hospital "Città della Salute e della Scienza di Torino"	0	0	0	1	0	0	0	1
Inherited Neuropathy Consortium	0	0	0	0	0	0	1	1
Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden	0	2	0	0	1	0	0	1
Institute for Genomic Medicine (IGM) Clinical Laboratory, Nationwide Children's Hospital	0	4	0	1	0	0	0	1
Institute of Immunology and Genetics Kaiserslautern	0	4	0	1	0	0	0	1
Institute of Medical Molecular Genetics, University of Zurich	0	0	0	1	0	0	0	1
Institute of Reproductive Genetics, University of Münster	0	0	0	1	0	0	0	1
Intergen Genetics and Rare Diseases Diagnosis Center	0	2	0	0	0	0	1	1
Johns Hopkins Genomics, Johns Hopkins University	0	6	0	1	0	0	0	1
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM)	0	0	0	1	0	0	0	1
KCCC/NGS Laboratory, Kuwait Cancer Control Center	0	1	0	1	0	0	0	1
Kasturba Medical College, Manipal, Kasturba Medical College, Manipal, Manipal Academy of Higher Education, Manipal, India	0	12	0	1	0	0	0	1
Lab De Baere, Eye and Developmental Genetics Lab, Ghent University	0	0	0	0	0	0	1	1
Laboratory of Genetics in Ophthalmology, Institut Imagine	0	2	0	1	0	0	0	1
Molecular Biology Laboratory, Fundació Puigvert	0	0	0	1	0	0	0	1
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute	0	2	0	0	1	0	0	1
Molecular Diagnostics Lab, Nemours Children's Health, Delaware	0	2	0	1	0	0	0	1
National Institute of Allergy and Infectious Diseases - Centralized Sequencing Program, National Institutes of Health	0	0	0	1	0	0	0	1
Neurogenetics Laboratory - MEYER, AOU Meyer	0	0	0	1	0	0	0	1
Newborn Screening Ontario, Children's Hospital of Eastern Ontario (CHEO)	0	2	0	0	0	0	1	1
Pediatric/Medical Genetics, Ministry of Health, Qatif Central Hospital	0	0	0	1	0	0	0	1
Practice for Gait Abnormalities, David Pomarino, Competency Network Toe Walking C/o Practice Pomarino	0	0	0	0	0	0	1	1
Quest Diagnostics Nichols Institute San Juan Capistrano	0	14	0	1	0	0	0	1
Rare Kidney Stone Consortium and the Mayo Clinic Hyperoxaluria Center, Mayo Clinic	0	1	0	1	0	0	0	1
RettBASE	0	2	0	1	0	0	0	1
SIB Swiss Institute of Bioinformatics	0	3	0	1	0	0	0	1
Sharon lab, Hadassah-Hebrew University Medical Center	0	0	0	1	0	0	0	1
UW Hindbrain Malformation Research Program, University of Washington	0	0	0	1	0	0	0	1

All variants with conflicting interpretations #

Total variants: 440

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_015602.4(TOR1AIP1):c.554-4G>A	rs2245425	0.59664
NM_000249.4(MLH1):c.1039-29A>T	rs6771325	0.48243
NM_020975.6(RET):c.2071G>A (p.Gly691Ser)	rs1799939	0.16948
NM_003465.3(CHIT1):c.1049_1072dup (p.Trp358Ter)	rs3831317	0.16576
NM_000141.5(FGFR2):c.557T>C (p.Met186Thr)	rs755793	0.10553
NM_013296.5(GPSM2):c.-258C>T	rs35520362	0.09545
NM_000036.3(AMPD1):c.143C>T (p.Pro48Leu)	rs61752479	0.08857
NM_000036.3(AMPD1):c.34C>T (p.Gln12Ter)	rs17602729	0.08701
NM_207346.3(TSEN54):c.3_8dup (p.2_3EP[4])	rs398124622	0.06950
NM_001852.4(COL9A2):c.976C>T (p.Gln326Ter)	rs12077871	0.04036
NM_001370658.1(BTD):c.1270G>C (p.Asp424His)	rs13078881	0.03225
NM_001453.3(FOXC1):c.889C>T (p.Pro297Ser)	rs79691946	0.03108
NM_000295.5(SERPINA1):c.-10T>C	rs11558258	0.02846
NM_001199107.2(TBC1D24):c.1143-6C>T	rs73490287	0.02047
NM_001206744.2(TPO):c.1587A>C (p.Leu529Phe)	rs114796303	0.01533
NM_000202.8(IDS):c.641C>T (p.Thr214Met)	rs61736892	0.01492
NM_005869.4(CWC27):c.938+3284G>A	rs114060499	0.01384
NM_023110.3(FGFR1):c.2314C>T (p.Pro772Ser)	rs56234888	0.01307
NM_000055.2(BCHE):c.293A>G (p.Asp98Gly)	rs1799807	0.01259
NM_024312.5(GNPTAB):c.1042A>C (p.Ile348Leu)	rs7958709	0.01184
NM_020374.4(FERRY3):c.1499-11T>G	rs115763051	0.01163
NM_000334.4(SCN4A):c.2717G>C (p.Ser906Thr)	rs41280102	0.01003
NM_006766.5(KAT6A):c.3577G>A (p.Val1193Ile)	rs34620183	0.00973
NM_144672.4(OTOA):c.2359G>T (p.Glu787Ter)	rs200988634	0.00927
NM_001330078.2(NRXN1):c.772+1140G>A	rs61658382	0.00837
NM_000124.4(ERCC6):c.3922G>C (p.Val1308Leu)	rs2229761	0.00814
NM_005689.4(ABCB6):c.1562C>G (p.Thr521Ser)	rs149363094	0.00792
NM_153460.4(IL17RC):c.1522+1G>C	rs148575246	0.00750
NM_000051.4(ATM):c.544G>C (p.Val182Leu)	rs3218707	0.00711
NM_022168.4(IFIH1):c.1641+1G>C	rs35337543	0.00707
NM_005529.7(HSPG2):c.3292G>A (p.Ala1098Thr)	rs2501264	0.00699
NM_025137.4(SPG11):c.3818A>G (p.Lys1273Arg)	rs76389165	0.00694
NM_022081.6(HPS4):c.751A>T (p.Thr251Ser)	rs34962745	0.00686
NM_005529.7(HSPG2):c.9719C>T (p.Ala3240Val)	rs62642505	0.00677
NM_001206744.2(TPO):c.2305C>T (p.Arg769Trp)	rs114406277	0.00629
NM_005529.7(HSPG2):c.3056C>T (p.Pro1019Leu)	rs62642528	0.00609
NM_006031.6(PCNT):c.5771C>T (p.Ala1924Val)	rs184420466	0.00604
NM_000512.5(GALNS):c.1438G>T (p.Val480Phe)	rs151296605	0.00559
NM_144687.4(NLRP12):c.3046C>T (p.Arg1016Ter)	rs35064500	0.00470
NM_016335.6(PRODH):c.865T>A (p.Leu289Met)	rs137852934	0.00464
NM_001277058.2(ERCC6):c.2249G>A (p.Cys750Tyr)	rs115162931	0.00462
NM_145309.6(LRRC51):c.352G>C (p.Gly118Arg)	rs149637884	0.00455
NM_000051.4(ATM):c.1810C>T (p.Pro604Ser)	rs2227922	0.00431
NM_032444.4(SLX4):c.1637A>G (p.Tyr546Cys)	rs150547487	0.00416
NM_001130987.2(DYSF):c.386G>A (p.Gly129Glu)	rs34997054	0.00411
NM_001142800.2(EYS):c.8429C>T (p.Thr2810Ile)	rs144513453	0.00410
NM_014625.4(NPHS2):c.59C>T (p.Pro20Leu)	rs74315344	0.00398
NM_000081.4(LYST):c.1686G>C (p.Gln562His)	rs77091385	0.00380
NM_000016.6(ACADM):c.985A>G (p.Lys329Glu)	rs77931234	0.00347
NM_152419.3(HGSNAT):c.1843G>A (p.Ala615Thr)	rs112029032	0.00346
NM_006059.4(LAMC3):c.2891-8C>T	rs199535979	0.00339
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr)	rs28935490	0.00315
NM_018122.5(DARS2):c.128-4A>T	rs769597479	0.00300
NM_207352.4(CYP4V2):c.610G>A (p.Ala204Thr)	rs61745524	0.00292
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln)	rs34324426	0.00283
NM_001369.3(DNAH5):c.4510G>C (p.Gly1504Arg)	rs143567667	0.00277
NM_000350.3(ABCA4):c.5882G>A (p.Gly1961Glu)	rs1800553	0.00269
NM_015409.5(EP400):c.4945G>A (p.Ala1649Thr)	rs148749054	0.00268
NM_015346.4(ZFYVE26):c.3722G>A (p.Arg1241Gln)	rs140756827	0.00258
NM_000552.5(VWF):c.4751A>G (p.Tyr1584Cys)	rs1800386	0.00237
NM_000153.4(GALC):c.334A>G (p.Thr112Ala)	rs147313927	0.00229
NM_001199107.2(TBC1D24):c.785C>T (p.Ser262Leu)	rs201060500	0.00216
NM_201378.4(PLEC):c.71-11512C>T	rs201053471	0.00215
NM_002335.4(LRP5):c.3107G>A (p.Arg1036Gln)	rs61889560	0.00207
NM_001164508.2(NEB):c.17497G>A (p.Val5833Ile)	rs149881695	0.00204
NM_201384.3(PLEC):c.5653G>A (p.Ala1885Thr)	rs201070741	0.00200
NM_206933.4(USH2A):c.4586A>T (p.Lys1529Ile)	rs41303255	0.00176
NM_203447.4(DOCK8):c.3460C>T (p.Arg1154Cys)	rs34390308	0.00170
NM_024753.5(TTC21B):c.2600G>A (p.Arg867His)	rs76726265	0.00161
NM_000302.4(PLOD1):c.77-3358C>T	rs534978828	0.00151
NM_000431.4(MVK):c.1129G>A (p.Val377Ile)	rs28934897	0.00149
NM_001142800.2(EYS):c.6632C>T (p.Ser2211Leu)	rs145623359	0.00140
NM_006214.4(PHYH):c.244C>G (p.Arg82Gly)	rs145404396	0.00140
NM_000431.4(MVK):c.924C>T (p.Leu308=)	rs72648042	0.00136
NM_001080414.4(CCDC88C):c.4327G>A (p.Ala1443Thr)	rs189215037	0.00133
NM_001042545.2(LTBP4):c.2909C>G (p.Pro970Arg)	rs200667255	0.00131
NM_014239.4(EIF2B2):c.380C>T (p.Ala127Val)	rs150617429	0.00127
NM_000104.4(CYP1B1):c.1103G>A (p.Arg368His)	rs79204362	0.00125
NM_001875.5(CPS1):c.3643A>G (p.Ile1215Val)	rs141373204	0.00123
NM_004380.3(CREBBP):c.5719G>A (p.Ala1907Thr)	rs199990883	0.00120
NM_001267550.2(TTN):c.21779C>A (p.Ser7260Tyr)	rs187925021	0.00118
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys)	rs1801155	0.00116
NM_005562.3(LAMC2):c.196G>A (p.Glu66Lys)	rs146325169	0.00114
NM_000069.3(CACNA1S):c.3795+3G>A	rs191758096	0.00113
NM_017672.6(TRPM7):c.536-4A>G	rs189266420	0.00113
NM_032119.4(ADGRV1):c.4214C>T (p.Ser1405Phe)	rs41305898	0.00104
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr)	rs72677243	0.00093
NM_080911.3(UNG):c.262C>T (p.Arg88Cys)	rs151095402	0.00090
NM_002968.3(SALL1):c.1878G>C (p.Glu626Asp)	rs80248061	0.00089
NM_013391.3(DMGDH):c.972G>A (p.Trp324Ter)	rs139044238	0.00088
NM_001042545.2(LTBP4):c.2681-10C>G	rs200914063	0.00084
NM_206933.4(USH2A):c.5858C>G (p.Ala1953Gly)	rs41302239	0.00081
NM_138694.4(PKHD1):c.7912-5T>G	rs371510537	0.00075
NM_001039141.3(TRIOBP):c.2201C>T (p.Ser734Phe)	rs199794705	0.00073
NM_001364905.1(LRBA):c.2209G>A (p.Val737Ile)	rs151213445	0.00072
NM_001035235.4(SRA1):c.500T>C (p.Ile167Thr)	rs148108594	0.00066
NM_033004.4(NLRP1):c.1887C>A (p.Phe629Leu)	rs149035689	0.00063
NM_001365536.1(SCN9A):c.4315G>A (p.Val1439Ile)	rs149346064	0.00061
NM_004153.4(ORC1):c.1745A>G (p.Gln582Arg)	rs547441862	0.00061
NM_005751.5(AKAP9):c.5246T>C (p.Ile1749Thr)	rs150016098	0.00061
NM_016356.5(DCDC2):c.817C>T (p.Pro273Ser)	rs146787541	0.00061
NM_000054.7(AVPR2):c.1055G>A (p.Gly352Asp)	rs146350208	0.00060
NM_001127649.3(PEX26):c.643G>A (p.Glu215Lys)	rs138232280	0.00060
NM_000023.4(SGCA):c.421C>A (p.Arg141Ser)	rs35130237	0.00058
NM_024678.6(NARS2):c.1082A>G (p.Asn361Ser)	rs150355410	0.00054
NM_032444.4(SLX4):c.2975G>A (p.Gly992Glu)	rs139287784	0.00054
NM_138694.4(PKHD1):c.5134G>A (p.Gly1712Arg)	rs141103838	0.00054
NM_001849.4(COL6A2):c.2182G>A (p.Val728Met)	rs200585528	0.00051
NM_014629.4(ARHGEF10):c.2063G>A (p.Ser688Asn)	rs143290224	0.00051
NM_001756.4(SERPINA6):c.1165G>A (p.Asp389Asn)	rs28929488	0.00049
NM_145207.3(AFG2A):c.1622C>G (p.Pro541Arg)	rs143957561	0.00049
NM_182961.4(SYNE1):c.16850G>A (p.Arg5617Gln)	rs141550859	0.00049
NM_138694.4(PKHD1):c.107C>T (p.Thr36Met)	rs137852944	0.00048
NM_000500.9(CYP21A2):c.1447C>T (p.Pro483Ser)	rs776989258	0.00047
NM_000312.4(PROC):c.565C>T (p.Arg189Trp)	rs146922325	0.00046
NM_001377.3(DYNC2H1):c.1774C>T (p.Leu592Phe)	rs180861816	0.00046
NM_004369.4(COL6A3):c.9128G>A (p.Arg3043His)	rs552651651	0.00044
NM_001363711.2(DUOX2):c.1709A>T (p.Gln570Leu)	rs547116063	0.00042
NM_001164508.2(NEB):c.539A>G (p.Lys180Arg)	rs200719359	0.00041
NM_020442.6(VARS2):c.1691C>T (p.Ala564Val)	rs143408155	0.00041
NM_000751.3(CHRND):c.727C>T (p.Arg243Cys)	rs201733876	0.00040
NM_001099922.3(ALG13):c.2248-15G>C	rs139711892	0.00040
NM_144585.4(SLC22A12):c.1400C>T (p.Thr467Met)	rs200104135	0.00039
NM_145064.3(STAC3):c.851G>C (p.Trp284Ser)	rs140291094	0.00039
NM_014249.4(NR2E3):c.119-2A>C	rs2723341	0.00038
NM_000203.5(IDUA):c.299+988C>T	rs142262555	0.00037
NM_001128840.3(CACNA1D):c.2729G>A (p.Arg910His)	rs115066564	0.00036
NM_198578.4(LRRK2):c.6055G>A (p.Gly2019Ser)	rs34637584	0.00036
NM_001099274.3(TINF2):c.734C>A (p.Ser245Tyr)	rs142777869	0.00034
NM_000350.3(ABCA4):c.5714+5G>A	rs61751407	0.00032
NM_001161352.2(KCNMA1):c.2267-4486C>T	rs188354139	0.00032
NM_001457.4(FLNB):c.4061+4G>A	rs370061963	0.00032
NM_000081.4(LYST):c.5634+11A>G	rs373971587	0.00031
NM_001298.3(CNGA3):c.967G>C (p.Ala323Pro)	rs146195955	0.00030
NM_000158.4(GBE1):c.986A>G (p.Tyr329Cys)	rs80338671	0.00029
NM_000350.3(ABCA4):c.5461-10T>C	rs1800728	0.00029
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe)	rs5030868	0.00028
NM_022168.4(IFIH1):c.2016del (p.Asp673fs)	rs773033563	0.00027
NM_005033.3(EXOSC9):c.41T>C (p.Leu14Pro)	rs139632595	0.00026
NM_005419.4(STAT2):c.250C>A (p.Gln84Lys)	rs150901100	0.00024
NM_001370466.1(NOD2):c.1036C>T (p.Arg346Cys)	rs145293873	0.00023
NM_080680.3(COL11A2):c.2536C>T (p.Arg846Trp)	rs149071920	0.00023
NM_001292063.2(OTOG):c.3751G>A (p.Gly1251Ser)	rs769211682	0.00021
NM_024422.6(DSC2):c.907G>A (p.Val303Met)	rs145560678	0.00021
NM_001363711.2(DUOX2):c.1825C>T (p.Pro609Ser)	rs201221237	0.00018
NM_198253.3(TERT):c.604G>A (p.Ala202Thr)	rs121918661	0.00018
NM_001458.5(FLNC):c.1976T>G (p.Leu659Arg)	rs576402053	0.00017
NM_001848.3(COL6A1):c.2091G>A (p.Met697Ile)	rs372750707	0.00017
NM_000492.4(CFTR):c.3909C>G (p.Asn1303Lys)	rs80034486	0.00016
NM_000545.8(HNF1A):c.716C>T (p.Ala239Val)	rs587778397	0.00016
NM_015158.5(KANK1):c.2615C>G (p.Ser872Cys)	rs148558003	0.00016
NM_018941.4(CLN8):c.806A>T (p.Glu269Val)	rs139003032	0.00016
NM_001005242.3(PKP2):c.1951C>T (p.Arg651Cys)	rs199583774	0.00015
NM_000243.3(MEFV):c.2080A>G (p.Met694Val)	rs61752717	0.00012
NM_001360.3(DHCR7):c.1091C>T (p.Thr364Met)	rs567600444	0.00012
NM_001370658.1(BTD):c.1429C>T (p.Pro477Ser)	rs138818907	0.00012
NM_000365.6(TPI1):c.315G>C (p.Glu105Asp)	rs121964845	0.00011
NM_000746.6(CHRNA7):c.1405C>T (p.Arg469Cys)	rs1170628768	0.00011
NM_032119.4(ADGRV1):c.155G>A (p.Arg52His)	rs199798095	0.00011
NM_053025.4(MYLK):c.3112A>G (p.Met1038Val)	rs763247566	0.00011
NM_173842.3(IL1RN):c.529G>A (p.Glu177Lys)	rs114929884	0.00011
NM_001370658.1(BTD):c.1535C>T (p.Thr512Met)	rs104893688	0.00010
NM_032119.4(ADGRV1):c.466G>A (p.Ala156Thr)	rs201180985	0.00010
NM_133379.5(TTN):c.16001C>T (p.Pro5334Leu)	rs151253841	0.00010
NM_152564.5(VPS13B):c.2885C>T (p.Thr962Met)	rs547184348	0.00010
NM_000038.6(APC):c.7781C>G (p.Ser2594Cys)	rs543396310	0.00009
NM_000341.4(SLC3A1):c.647C>T (p.Thr216Met)	rs369641941	0.00009
NM_006785.4(MALT1):c.1282G>A (p.Val428Ile)	rs140664950	0.00009
NM_012452.3(TNFRSF13B):c.577T>C (p.Cys193Arg)	rs764125338	0.00009
NM_182919.4(TICAM1):c.1774G>A (p.Gly592Arg)	rs74359855	0.00009
NM_000540.3(RYR1):c.10648C>T (p.Arg3550Trp)	rs536304635	0.00008
NM_173660.5(DOK7):c.1133C>T (p.Ala378Val)	rs371846002	0.00008
NM_000243.3(MEFV):c.2082G>A (p.Met694Ile)	rs28940578	0.00007
NM_000335.5(SCN5A):c.1336G>A (p.Glu446Lys)	rs199473339	0.00007
NM_000540.3(RYR1):c.6670C>T (p.Arg2224Cys)	rs199870223	0.00007
NM_001378778.1(MPDZ):c.394G>A (p.Gly132Ser)	rs201101621	0.00007
NM_001005361.3(DNM2):c.2201A>G (p.Asn734Ser)	rs577767034	0.00006
NM_001103146.3(GIGYF2):c.2378C>T (p.Ala793Val)	rs748538823	0.00006
NM_003060.4(SLC22A5):c.248G>T (p.Arg83Leu)	rs72552726	0.00006
NM_003126.4(SPTA1):c.779T>C (p.Leu260Pro)	rs121918634	0.00006
NM_004946.3(DOCK2):c.2704-3C>T	rs144101028	0.00006
NM_005422.4(TECTA):c.1621G>A (p.Val541Met)	rs370652301	0.00006
NM_138694.4(PKHD1):c.4870C>T (p.Arg1624Trp)	rs200391019	0.00006
NM_182548.4(LHFPL5):c.472C>T (p.Arg158Trp)	rs753739358	0.00006
NM_000243.3(MEFV):c.460T>C (p.Ser154Pro)	rs756975501	0.00005
NM_000441.2(SLC26A4):c.716T>A (p.Val239Asp)	rs111033256	0.00005
NM_000492.4(CFTR):c.3409A>G (p.Met1137Val)	rs397508553	0.00005
NM_001100913.3(PACS2):c.1269-4A>G	rs376690008	0.00005
NM_001277115.2(DNAH11):c.2750A>T (p.Glu917Val)	rs543944909	0.00005
NM_001364905.1(LRBA):c.3805C>G (p.Pro1269Ala)	rs555169864	0.00005
NM_001737.5(C9):c.460C>T (p.Arg154Ter)	rs144138616	0.00005
NM_004153.4(ORC1):c.608C>T (p.Thr203Ile)	rs202095223	0.00005
NM_004827.3(ABCG2):c.791_792del (p.Leu264fs)	rs387906870	0.00005
NM_005458.8(GABBR2):c.613G>A (p.Val205Ile)	rs146801036	0.00005
NM_015466.4(PTPN23):c.4844G>A (p.Arg1615Gln)	rs754863024	0.00005
NM_181882.3(PRX):c.1090C>T (p.Arg364Ter)	rs144183238	0.00005
NM_000277.3(PAH):c.842+1G>A	rs5030852	0.00004
NM_000492.4(CFTR):c.358G>A (p.Ala120Thr)	rs201958172	0.00004
NM_000512.5(GALNS):c.319G>A (p.Ala107Thr)	rs763184657	0.00004
NM_001126108.2(SLC12A3):c.248G>A (p.Arg83Gln)	rs768527231	0.00004
NM_000303.3(PMM2):c.712C>T (p.Arg238Cys)	rs142459706	0.00003
NM_000350.3(ABCA4):c.4328G>A (p.Arg1443His)	rs61750142	0.00003
NM_000492.4(CFTR):c.3208C>T (p.Arg1070Trp)	rs202179988	0.00003
NM_001010867.4(IBA57):c.316A>G (p.Thr106Ala)	rs1053773776	0.00003
NM_001079855.2(GYG2):c.377C>T (p.Pro126Leu)	rs767864277	0.00003
NM_001369.3(DNAH5):c.5503C>T (p.Gln1835Ter)	rs761622153	0.00003
NM_001385641.1(SAMD11):c.1336G>A (p.Ala446Thr)	rs571654307	0.00003
NM_001673.5(ASNS):c.146G>A (p.Arg49Gln)	rs769236847	0.00003
NM_002225.5(IVD):c.1175G>A (p.Arg392His)	rs982218848	0.00003
NM_003791.4(MBTPS1):c.1658C>T (p.Ser553Leu)	rs553862782	0.00003
NM_004183.4(BEST1):c.37C>T (p.Arg13Cys)	rs886041141	0.00003
NM_005912.3(MC4R):c.896C>A (p.Pro299His)	rs52804924	0.00003
NM_006759.4(UGP2):c.34A>G (p.Met12Val)	rs768305634	0.00003
NM_013254.4(TBK1):c.1839G>T (p.Leu613Phe)	rs368859659	0.00003
NM_019892.6(INPP5E):c.1534C>T (p.Arg512Trp)	rs374152018	0.00003
NM_052867.4(NALCN):c.2495A>G (p.Tyr832Cys)	rs549182297	0.00003
NM_138425.4(C12orf57):c.1A>G (p.Met1Val)	rs587776954	0.00003
NM_153026.3(PRICKLE1):c.311G>A (p.Arg104Gln)	rs113994140	0.00003
NM_198053.3(CD247):c.58+8C>T	rs201494226	0.00003
NM_201253.3(CRB1):c.2234C>T (p.Thr745Met)	rs28939720	0.00003
NM_000091.5(COL4A3):c.898G>A (p.Gly300Arg)	rs772708743	0.00002
NM_000152.5(GAA):c.2015G>A (p.Arg672Gln)	rs778418246	0.00002
NM_000426.4(LAMA2):c.4456G>A (p.Ala1486Thr)	rs372576669	0.00002
NM_000441.2(SLC26A4):c.1667A>G (p.Tyr556Cys)	rs763006761	0.00002
NM_000441.2(SLC26A4):c.200C>G (p.Thr67Ser)	rs111033240	0.00002
NM_000463.3(UGT1A1):c.1021C>T (p.Arg341Ter)	rs72551349	0.00002
NM_000463.3(UGT1A1):c.625C>T (p.Arg209Trp)	rs72551343	0.00002
NM_001039569.2(AP1S3):c.248T>C (p.Ile83Thr)	rs202157374	0.00002
NM_001128126.3(AP4S1):c.295-3C>A	rs185246578	0.00002
NM_001164508.2(NEB):c.19325G>A (p.Arg6442Gln)	rs375182306	0.00002
NM_001205254.2(OCLN):c.1037+1G>A	rs748442113	0.00002
NM_001298.3(CNGA3):c.847C>T (p.Arg283Trp)	rs104893613	0.00002
NM_001370658.1(BTD):c.497G>A (p.Cys166Tyr)	rs397514369	0.00002
NM_001377.3(DYNC2H1):c.4267C>T (p.Arg1423Cys)	rs745870321	0.00002
NM_004369.4(COL6A3):c.2497+9C>A	rs774198344	0.00002
NM_014297.5(ETHE1):c.488G>A (p.Arg163Gln)	rs745656120	0.00002
NM_018418.5(SPATA7):c.288T>A (p.Cys96Ter)	rs767745816	0.00002
NM_000016.6(ACADM):c.362C>T (p.Thr121Ile)	rs121434283	0.00001
NM_000048.4(ASL):c.332G>A (p.Arg111Gln)	rs561367199	0.00001
NM_000081.4(LYST):c.2724C>T (p.Cys908=)	rs201440611	0.00001
NM_000152.5(GAA):c.1327-2A>G	rs1410829147	0.00001
NM_000152.5(GAA):c.2783A>G (p.Tyr928Cys)	rs1403885484	0.00001
NM_000163.5(GHR):c.508G>C (p.Asp170His)	rs121909366	0.00001
NM_000196.4(HSD11B2):c.623G>A (p.Arg208His)	rs28934592	0.00001
NM_000294.3(PHKG2):c.469G>A (p.Glu157Lys)	rs752961445	0.00001
NM_000322.5(PRPH2):c.659G>A (p.Arg220Gln)	rs61755810	0.00001
NM_000350.3(ABCA4):c.4793C>A (p.Ala1598Asp)	rs61750155	0.00001
NM_000382.3(ALDH3A2):c.682C>T (p.Arg228Cys)	rs72547566	0.00001
NM_000441.2(SLC26A4):c.1963A>G (p.Ile655Val)	rs397516424	0.00001
NM_000441.2(SLC26A4):c.706C>G (p.Leu236Val)	rs111033242	0.00001
NM_000487.6(ARSA):c.449C>T (p.Pro150Leu)	rs199476375	0.00001
NM_000520.6(HEXA):c.2T>C (p.Met1Thr)	rs786204721	0.00001
NM_000552.5(VWF):c.4135C>T (p.Arg1379Cys)	rs61750074	0.00001
NM_001032386.2(SUOX):c.650G>A (p.Arg217Gln)	rs121908007	0.00001
NM_001080397.3(SLC45A1):c.526C>T (p.Arg176Trp)	rs781036625	0.00001
NM_001134407.3(GRIN2A):c.77C>T (p.Ala26Val)	rs765986049	0.00001
NM_001142800.2(EYS):c.4045C>T (p.Arg1349Ter)	rs930421180	0.00001
NM_001159773.2(CANT1):c.899G>A (p.Arg300His)	rs267606699	0.00001
NM_001252024.2(TRPM1):c.1263G>A (p.Pro421=)	rs768701595	0.00001
NM_001277115.2(DNAH11):c.4491G>A (p.Glu1497=)	rs564202359	0.00001
NM_001289125.3(IFNAR2):c.437A>G (p.Asn146Ser)	rs549962048	0.00001
NM_001298.3(CNGA3):c.1114C>T (p.Pro372Ser)	rs1464167194	0.00001
NM_001370658.1(BTD):c.1147T>G (p.Phe383Val)	rs104893686	0.00001
NM_001875.5(CPS1):c.937A>G (p.Met313Val)	rs587780323	0.00001
NM_001918.5(DBT):c.1281+1G>T	rs1557943881	0.00001
NM_002225.5(IVD):c.1184G>A (p.Arg395Gln)	rs1477527791	0.00001
NM_002769.5(PRSS1):c.365G>A (p.Arg122His)	rs111033565	0.00001
NM_003159.3(CDKL5):c.2809_2810insA (p.Cys937Ter)	rs1158418673	0.00001
NM_004369.4(COL6A3):c.3617C>T (p.Thr1206Ile)	rs949598599	0.00001
NM_004369.4(COL6A3):c.3668T>C (p.Leu1223Pro)	rs772944531	0.00001
NM_004614.5(TK2):c.173A>G (p.Asn58Ser)	rs138439950	0.00001
NM_004813.4(PEX16):c.859C>T (p.Arg287Cys)	rs769772100	0.00001
NM_004975.4(KCNB1):c.1883G>A (p.Gly628Glu)	rs181378121	0.00001
NM_005264.8(GFRA1):c.676C>T (p.Arg226Ter)	rs191814086	0.00001
NM_005373.3(MPL):c.317C>T (p.Pro106Leu)	rs750046020	0.00001
NM_005609.4(PYGM):c.1708C>T (p.Arg570Trp)	rs377225525	0.00001
NM_006397.3(RNASEH2A):c.557G>A (p.Arg186Gln)	rs753679297	0.00001
NM_007373.4(SHOC2):c.4A>G (p.Ser2Gly)	rs267607048	0.00001
NM_014946.4(SPAST):c.1245+1G>A	rs875989878	0.00001
NM_015178.3(RHOBTB2):c.508C>T (p.Pro170Ser)	rs761440038	0.00001
NM_016464.5(TMEM138):c.128+5G>A	rs917404097	0.00001
NM_018026.4(PACS1):c.607C>T (p.Arg203Trp)	rs398123009	0.00001
NM_018122.5(DARS2):c.1825C>T (p.Arg609Trp)	rs200670286	0.00001
NM_018699.4(PRDM5):c.670A>T (p.Lys224Ter)	rs1064794819	0.00001
NM_019892.6(INPP5E):c.1543C>T (p.Arg515Trp)	rs13297509	0.00001
NM_019892.6(INPP5E):c.1688G>A (p.Arg563His)	rs121918128	0.00001
NM_020964.3(EPG5):c.1249C>T (p.Arg417Ter)	rs961245497	0.00001
NM_021831.6(AGBL5):c.826C>T (p.Arg276Trp)	rs879253769	0.00001
NM_138422.4(ADAT3):c.430G>A (p.Val144Met)	rs730882213	0.00001
NM_144687.4(NLRP12):c.1952C>A (p.Ser651Ter)	rs781361326	0.00001
NM_199242.3(UNC13D):c.3141C>A (p.Pro1047=)	rs866899109	0.00001
NM_000019.4(ACAT1):c.86_87dup (p.Glu30fs)	rs1591360348
NM_000051.4(ATM):c.8977C>T (p.Arg2993Ter)	rs770641163
NM_000081.4(LYST):c.6079G>C (p.Val2027Leu)	rs374351038
NM_000104.4(CYP1B1):c.1120G>A (p.Asp374Asn)	rs104893622
NM_000111.3(SLC26A3):c.1306C>T (p.Gln436Ter)	rs386833448
NM_000136.3(FANCC):c.165+1G>T	rs794726668
NM_000142.5(FGFR3):c.749C>G (p.Pro250Arg)	rs4647924
NM_000155.4(GALT):c.-119_-116delGTCA	rs111033640
NM_000156.6(GAMT):c.148A>C (p.Met50Leu)	rs104894694
NM_000169.3(GLA):c.1277_1278del (p.Lys426fs)	rs869312249
NM_000243.3(MEFV):c.2230G>T (p.Ala744Ser)	rs61732874
NM_000284.4(PDHA1):c.1142_1145dup (p.Trp383fs)	rs606231189
NM_000287.4(PEX6):c.855C>A (p.Pro285=)	rs757897959
NM_000330.4(RS1):c.52+3A>G	rs2147209764
NM_000350.3(ABCA4):c.2570T>C (p.Leu857Pro)	rs768435443
NM_000350.3(ABCA4):c.4567C>T (p.Gln1523Ter)	rs1553188916
NM_000350.3(ABCA4):c.5512C>G (p.His1838Asp)	rs62642562
NM_000383.4(AIRE):c.1637G>C (p.Ter546Ser)	rs1568932096
NM_000387.6(SLC25A20):c.82G>T (p.Gly28Cys)	rs747335514
NM_000414.4(HSD17B4):c.302+3_302+6del	rs863225438
NM_000428.3(LTBP2):c.4978G>T (p.Gly1660Trp)	rs147223742
NM_000441.2(SLC26A4):c.1265T>C (p.Val422Ala)	rs1057520369
NM_000441.2(SLC26A4):c.304G>A (p.Gly102Arg)	rs1219724284
NM_000489.6(ATRX):c.134-2A>G	rs398123420
NM_000492.3(CFTR):c.1210-12T[5]	rs1805177
NM_000492.3(CFTR):c.1521_1523del (p.Phe508del)	rs113993960
NM_000492.4(CFTR):c.523A>G (p.Ile175Val)	rs397508744
NM_000492.4(CFTR):c.850dup (p.Met284fs)	rs786204693
NM_000500.9(CYP21A2):c.293-13C>G	rs6467
NM_000527.5(LDLR):c.428G>T (p.Cys143Phe)	rs879254522
NM_000528.4(MAN2B1):c.2356-2A>G	rs1064793936
NM_000528.4(MAN2B1):c.2368C>T (p.Gln790Ter)
NM_000543.5(SMPD1):c.108_109insGCG (p.Val36_Leu37insAla)	rs775568984
NM_000932.5(PLCB3):c.2632G>T (p.Ala878Ser)	rs760695903
NM_001009944.3(PKD1):c.11888G>A (p.Trp3963Ter)
NM_001009944.3(PKD1):c.4825ATC[1] (p.Ile1610del)	rs1567198691
NM_001018115.3(FANCD2):c.2022-5C>T	rs4019784
NM_001024630.4(RUNX2):c.225GGCGGCTGCGGCGGCGGC[1] (p.Ala84_Ala89del)	rs11498192
NM_001029883.3(PCARE):c.2967del (p.Val990fs)	rs1667476173
NM_001035.3(RYR2):c.11092-11dup	rs397516499
NM_001042492.3(NF1):c.2410-12T>G	rs876657932
NM_001080453.3(INTS1):c.1138-11C>G	rs199689668
NM_001080467.3(MYO5B):c.1966C>T (p.Arg656Cys)	rs121908105
NM_001100913.3(PACS2):c.625G>A (p.Glu209Lys)	rs1555408401
NM_001101.5(ACTB):c.454G>A (p.Val152Met)	rs2128241296
NM_001110792.2(MECP2):c.33AGG[6] (p.Gly16dup)	rs587783744
NM_001110792.2(MECP2):c.722C>A (p.Ser241Ter)	rs61749739
NM_001110792.2(MECP2):c.799C>T (p.Arg267Ter)	rs61749721
NM_001130438.3(SPTAN1):c.3215+15_3215+16del	rs551595039
NM_001130438.3(SPTAN1):c.6899ACCAGCTGG[3] (p.2300DQL[3])	rs587784440
NM_001134831.2(AHI1):c.2988del (p.Val997fs)	rs755246809
NM_001139.3(ALOX12B):c.944T>C (p.Leu315Pro)	rs1977160529
NM_001166355.2(LFNG):c.163_166dup (p.Glu56delinsGlyTer)	rs34637446
NM_001190737.2(NFIB):c.265C>T (p.Arg89Ter)	rs764333096
NM_001195263.2(PDZD7):c.2209_2211delinsAA (p.Gln737fs)	rs2492782810
NM_001206999.2(CIT):c.29_38del (p.Asn10fs)	rs879253817
NM_001232.4(CASQ2):c.738-7_738-5del	rs56889721
NM_001232.4(CASQ2):c.738-8_738-5del	rs56889721
NM_001256545.2(MEGF10):c.1557del (p.Trp520fs)	rs1057518682
NM_001349338.3(FOXP1):c.1652+5G>A	rs794727216
NM_001353921.2(ARHGEF9):c.1497T>G (p.Phe499Leu)	rs2147114173
NM_001354768.3(NRL):c.339C>G (p.Tyr113Ter)	rs1566560531
NM_001370259.2(MEN1):c.784-9G>A	rs794728625
NM_001370466.1(NOD2):c.2641G>C (p.Gly881Arg)	rs2066845
NM_001370658.1(BTD):c.500del (p.Pro167fs)	rs2125500629
NM_001370658.1(BTD):c.545A>T (p.Asn182Ile)	rs397514376
NM_001372574.1(ATXN2):c.59AGC[8] (p.Gln28del)	rs10560189
NM_001378454.1(ALMS1):c.36GGA[12] (p.Glu28del)	rs55889738
NM_001378457.1(DMXL2):c.5827_5841del (p.Asp1943_Ser1947del)	rs606231461
NM_001384474.1(LOXHD1):c.4714C>T (p.Arg1572Ter)	rs75949023
NM_001384732.1(CPLANE1):c.8959-2A>G	rs2546659949
NM_001386393.1(PANK2):c.1112G>C (p.Arg371Pro)	rs1241995212
NM_001553.3(IGFBP7):c.830-1G>A	rs866994863
NM_001567.4(INPPL1):c.545C>A (p.Ser182Ter)	rs397514509
NM_001807.6(CEL):c.337C>T (p.Gln113Ter)	rs1200339761
NM_001940.4(ATN1):c.1464GCA[12] (p.Gln500_Gln502del)	rs60216939
NM_002180.3(IGHMBP2):c.2540del (p.Gln847fs)	rs1225532037
NM_002184.4(IL6ST):c.1841-4del	rs71602925
NM_002336.3(LRP6):c.4377dup (p.Tyr1460fs)	rs764620253
NM_002473.6(MYH9):c.5521G>A (p.Glu1841Lys)	rs80338834
NM_002474.3(MYH11):c.1033+1G>A	rs112534511
NM_002834.5(PTPN11):c.853T>G (p.Phe285Val)	rs397507531
NM_002968.2(SALL1):c.466_477dup (p.Ser159_Gly160insSerSerSerSer)	rs113614842
NM_004113.6(FGF12):c.155G>A (p.Arg52His)	rs886039903
NM_004168.4(SDHA):c.1909-12_1909-11del	rs372662724
NM_004183.4(BEST1):c.11C>T (p.Thr4Ile)	rs368383940
NM_004214.5(FIBP):c.175_176insTAA (p.His59delinsLeuAsn)	rs886037928
NM_004525.3(LRP2):c.7564T>C (p.Tyr2522His)	rs80338747
NM_004646.4(NPHS1):c.3418C>A (p.Arg1140Ser)	rs143092783
NM_004836.7(EIF2AK3):c.1570_1573del (p.Lys523_Glu524insTer)	rs1558652941
NM_004944.4(DNASE1L3):c.290_291del (p.Thr97fs)	rs751206379
NM_004999.4(MYO6):c.2898AGA[3] (p.Glu970del)	rs727504743
NM_005222.4(DLX6):c.81GCAGCAGCAGCAGCAGCAACAGCA[3] (p.Gln37_Gln44dup)	rs775320932
NM_005419.4(STAT2):c.1466C>T (p.Pro489Leu)	rs138681270
NM_005476.7(GNE):c.2086G>A (p.Val696Met)	rs121908627
NM_005807.6(PRG4):c.3254_3260dup (p.Val1088fs)	rs769917456
NM_005932.4(MIPEP):c.1027A>G (p.Lys343Glu)	rs1057518741
NM_006059.4(LAMC3):c.3250G>C (p.Glu1084Gln)	rs146221263
NM_006059.4(LAMC3):c.3379G>A (p.Glu1127Lys)	rs140955110
NM_006208.3(ENPP1):c.313+8_313+9insTTGTGT	rs879243445
NM_006208.3(ENPP1):c.313+9GT[20]	rs59956343
NM_006912.6(RIT1):c.170C>G (p.Ala57Gly)	rs672601334
NM_006912.6(RIT1):c.246T>G (p.Phe82Leu)	rs730881014
NM_007009.3(ZPBP):c.50G>C (p.Arg17Pro)	rs202231065
NM_007254.4(PNKP):c.1360C>A (p.Leu454Met)	rs200611702
NM_007272.3(CTRC):c.738_761del (p.Lys247_Arg254del)	rs515726210
NM_007347.5(AP4E1):c.3214_3215del (p.Leu1072fs)	rs757657323
NM_012079.6(DGAT1):c.1095G>A (p.Trp365Ter)	rs2488948958
NM_014241.4(HACD1):c.458G>A (p.Trp153Ter)	rs2493868037
NM_014738.6(TMEM94):c.810del (p.Asp270fs)	rs1567950778
NM_014875.3(KIF14):c.4475del (p.Asp1492fs)	rs2527210283
NM_016077.5(PTRH2):c.324G>A (p.Trp108Ter)	rs1268684924
NM_016464.5(TMEM138):c.380C>T (p.Ala127Val)	rs387907133
NM_016648.4(LARP7):c.731del (p.Ser244fs)	rs752648225
NM_017662.5(TRPM6):c.2998dup (p.Ser1000fs)	rs2489968400
NM_020427.3(SLURP1):c.1A>C (p.Met1Leu)	rs28937889
NM_020988.3(GNAO1):c.680C>T (p.Ala227Val)	rs797045599
NM_024665.7(TBL1XR1):c.226C>T (p.Arg76Ter)	rs1577029680
NM_024757.5(EHMT1):c.21+1_21+5del	rs1842769868
NM_030632.3(ASXL3):c.4219_4220del (p.Leu1407fs)	rs1555744178
NM_030632.3(ASXL3):c.6078_6083del (p.Pro2027_Pro2028del)	rs1235588816
NM_030787.4(CFHR5):c.486dup (p.Glu163fs)	rs565457964
NM_031924.8(RSPH3):c.-260dup	rs751193355
NM_032193.4(RNASEH2C):c.205C>T (p.Arg69Trp)	rs78635798
NM_032603.5(LOXL3):c.449delinsAA (p.Pro150fs)	rs2530025111
NM_032620.4(GTPBP3):c.1291dup (p.Arg431fs)	rs869320746
NM_033419.5(PGAP3):c.851A>G (p.His284Arg)	rs776720232
NM_052867.4(NALCN):c.4104-19dup	rs113354194
NM_058172.6(ANTXR2):c.134T>C (p.Leu45Pro)	rs886041401
NM_080680.3(COL11A2):c.966dup (p.Thr323fs)	rs748440351
NM_130837.3(OPA1):c.2873_2876del	rs80356530
NM_130839.5(UBE3A):c.2567_2570del (p.Lys856fs)	rs587784527
NM_133497.4(KCNV2):c.427G>T (p.Glu143Ter)	rs104894113
NM_138554.5(TLR4):c.526_544del (p.Asn176fs)	rs749154041
NM_138927.4(SON):c.5943_5963del (p.1957SRTPSRR[5])	rs766784590
NM_139276.3(STAT3):c.1979T>C (p.Met660Thr)	rs886039434
NM_144639.3(UROC1):c.855G>A (p.Trp285Ter)	rs781621925
NM_145239.3(PRRT2):c.649dup (p.Arg217fs)	rs587778771
NM_152564.5(VPS13B):c.7365del (p.Cys2455fs)	rs1811766430
NM_152618.3(BBS12):c.1993GTT[1] (p.Val666del)	rs779685329
NM_152732.5(RSPH9):c.801GAA[1] (p.Lys268del)	rs397515340
NM_172107.4(KCNQ2):c.1678C>T (p.Arg560Trp)	rs773171451
NM_173660.5(DOK7):c.1124_1127dup (p.Ala378fs)	rs606231128
NM_177400.3(NKX6-2):c.608G>A (p.Trp203Ter)	rs1565019928
NM_177559.3(CSNK2A1):c.239G>A (p.Arg80His)	rs1057518092
NM_178012.5(TUBB2B):c.743C>T (p.Ala248Val)	rs777598117
NM_178172.6(GPIHBP1):c.523G>C (p.Gly175Arg)	rs145844329
NM_201253.3(CRB1):c.2505_2508del (p.Pro836fs)	rs778419716
NM_206538.4(EMC10):c.287del (p.Gly96fs)	rs770255014

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. The submitted information has not been verified. If you have questions about the information contained on this website, please see a health care professional.